Run-Time Errors

Damn it

2009-12-26T00:16:32Z

Man I hate Christmas.

It wouldn't be so bad if it were just a matter of being alone, but everything is closed.

I guess I can work on configuring Nagios or something...

Iteration

2009-12-23T10:55:42Z

GATTACAGATTACAGATTACAGATTACA goes my DNA, and CGUCUGAUGUCGUGUGUA goes the messenger RNA off to the ribosomes in my cells, cranking out proteins as ordered, built from whatever transfer RNA they just cranked out a fraction of a second ago.

CAGCAGCAGCAGCAGCAG, goes my DNA after a while, more and more-- the sequence growing from time to time when my cells divide and replace each other-- and some of the proteins get longer and longer.

Eventually, I will have cells full of so much bulk protein glue that nothing else gets done, and replication, of course, will not fix the problem.

This is how we will die, after cancer per se is cured, unless we determine how to cause our ribosomes to print catalytic enzymes that cleave those proteins into pieces small enough for our cells to dispose of, or somehow selectively shred the CAG repeats during translation or transcription.

This is also why it is currently less obvious that some of the population is already largely resistant to cancer: diseases like this, which will eventually affect most people late in life, are currently "rare"-- confined to people genetically predisposed to them, or cultures where couples breed late in life, when their own gametes are more likely to have a head start on the failure mode-- also afflict the very old, at the age we tend to think of as the end of an uncommonly long lifespan.

Shortly, however, that is going to become the median life expectancy.

These diseases aren't going to be "rare" at all.

I think

2009-12-21T10:35:05Z

I need, badly need, something to just blow my mind again.

Or Something

2009-12-09T03:12:46Z

Apparently I'm an uncle.

Hmm.

I hate the holidays

2009-11-26T21:51:55Z

I hate the holidays. Everything is either closed or packed to the rafters with crazy people.

It's like Omega Man, only I can't just break in and take what I need to survive from the closed places, or shoot the crazy people. And I'm not playing chess across from a bust of Caesar.

Okay, maybe it's not like Omega Man. But it sucks.

Fuck it, I'm just going to do laundry, watch Full Metal Jacket on Netflix, and try not to think to hard about how much I hate being single.

Suggestions Welcome

2009-11-23T08:14:43Z

What are you supposed to do when you're lonely, but tired of trying to start conversations?

Posted via LiveJournal.app.

Lame

2009-11-23T06:04:06Z

This whole "not having anybody to snuggle except once in a blue moon" thing really sucks. Of course, trying to date somebody seriously didn't work out too well either.

I guess I'm just killing time. At least it goes by faster every year.

Last Night

2009-11-22T22:10:41Z

Walking around in San Jose, I saw three women walking and some kid in a BMW pacing them and trying to hit on them. They were doing their best to blow him off, and he eventually sped up. They started muttering about him, and the car, and I laughed.

Me: I used to see a lot of that in Sacramento. But the thing there was, most of those cars were rebuilt salvage. You'd see a parking lot full of Mercedes and BMWs, and at least half of them had been totaled.

F1: Do you have a 401k?

Me: After this crash? Fuck no.

F2: Well, at least he's honest...

F3: That's true.

I shit you not.

Quote of the Evening

2009-11-20T07:23:59Z

F: "We were sitting here."
Me: "And Kennedy was the President, but things change."

Posted via LiveJournal.app.

Tonight's Exchange

2009-11-17T10:29:38Z

F: (walks up) "Would you like to buy my friends and I a drink?"
Me: "Why would I do that?"
F: "Are you gay?"
Me: "No, I just like women who work for a living."
F: "I work for a living."
Me: "Do you believe in women's rights?"
F: "Yes..."
Me: "So buy your own drinks."
F: "You're gay. And you're baaaaaaaaald."
Me: "And you're flat."

I will never understand why women think calling a guy bald is an insult. Baldness is caused by excessive testosterone. Excessive testosterone means you either are, or at a minimum have the option of being on demand, a mean motherfucker who gets it the fuck done. It means you're an appreciating asset, as your earning potential increases year after year, as opposed to somebody leaning on their looks-- which decrease year after year, leaving them as a depreciating asset.

Yeah, sweetheart. Bald. Ohhhhhh, so bald. Mmmmmmmm, bald, bald, bald.

Actually, I can still pull off a crew cut. But with any luck, I'll be able to go Telly fucking Savalas-- and make a bid for Oracle-- in a few short years.

SITREP

2009-11-14T05:48:41Z

Alone in a bar, but making $65 an hour while having a beer isn't a bad way to go.

Thank god for cellular networks, and the fact that when I'm only using this laptop as a VPN/VNC terminal, the battery lasts for hours.

Personal Knowledge Gained from Operations in California, 1995-2009

2009-10-21T20:34:24Z

Rules of Engagement for 2010

1. Don't say anything you don't have to.
Follow this rule even when being friendly and outgoing.

2. There is only so deep you should allow yourself to fall in love-- ever.
No exceptions. Mandatory contingency damage mitigation. Make sure that if things ever go wrong, there is only so much damage they can do.

3. Keep things symmetric-- event by event, if possible.
Splitting the check is better than letting someone say "I'll get you next time". Planning an evening together beats planning everything yourself because the other person doesn't care.

4. Everybody wants something, even if they don't know what it is.
Internal motivation is more dangerous than deliberate motivation-- it's harder to stop, and the people slaved to it are convinced they have no idea where they're going, so they rarely admit they're doing it.

5. They never call.
Keep this in mind when you consider breaking rule 2 as part of "meeting" a girl, particularly when she introduces herself. See rule 4.

And, of course, the Old Rules still apply:

1. Never go against your gut.
2. Once is a coincidence, twice is interesting, three times is an enemy action.
3. Never underestimate the ability of a human being to rationalize the truth.

Older

2009-10-12T06:13:44Z

I feel like I finally have enough freedom of action to cut loose, and all my friends are at the point where they stay home all the time.

Now what?

Posted via LiveJournal.app.

Greetings from LoveFest

2009-10-12T06:12:15Z

Old, but apparently never posted successfully:

Very crowded. Ten thousand pretty girls.

Happy me.

Posted via LiveJournal.app.

Thought for the Day

2009-09-30T02:10:24Z

Only CalTrain could come up with the concept of a "southbound elevator".

CalTrain. Get Out of the Fucking Way. (sm)

Posted via LiveJournal.app.

Bootie

2009-09-13T08:15:39Z

Great time at the DNA Lounge. Get here if you can.

And hey, spray paint an ABC car on the way over.

Posted via LiveJournal.app.

Review: The Man from Earth

2009-09-13T00:06:29Z

(This is a review originally intended for, but too long for, Netflix, of "The Man from Earth.")

In The Man from Earth, Jerome Bixby (famous for, among other things, the Star Trek story Mirror, Mirror) provides a canvas to make us consider two intertwined stories: first, what would a human life, over many thousand years, subjectively feel like; second, how does history distort, amplify, and ultimately turn on the actual events on which it is based?

Independent film and science fiction fans will want to give this a look, as will character actors. Writers will enjoy paying attention to where both the actors and the audience are pulled into, and out of, the story, deliberately.

Rod Serling observed in a number of interviews that television existed to provide both art and entertainment, and that the medium was, by necessity, both commercial and intellectual. Consequently, Serlings work was occasionally pure entertainment, and occasionally pure art. In much the same way, The Man from Earth is, while far from perfect, an intellectual work of art. Some of the themes discussed all but rule out much commercial exploitation. The acting could use some work in a few scenes, but pay attention to that, because whats really interesting and telling here, if youre interested in the dynamics of film and television, is the way the actors themselves, not just their characters, come to life when some of the more polarizing issues are raised.

This is a fascinating movie to watch if youre interested in seeing a script force an actor out of simply being in character and actually really get involved in a discussion that would almost impossible to participate in dispassionately.

Again, its not perfect, but its very different. Watch for the things that are done differently from a typical drama or science fiction movie, and pay attention to how effective the work is for what was obviously a very low-- but well-used and entirely adequate-- budget.

Fine work all-around. It says a lot about the players that they were interesting and open-minded enough to embrace a controversial story. Kudos should also be given to both photographic direction and editing, as proper work in both of those departments definitely makes this effectively two-set film much easier to watch.

Sonofabitch!

2009-08-29T19:03:07Z

Fuck!

I just caught three fucking sorority girls trying to either case or lift my shit from inside the gated area of my house!

I heard a clat that turned out to be them dropping some damned church flyer against my door. Let me be clear: the outside door into my apartment is not accessible from the street. Someone left the gate open, it seems, and they just wandered right on in. This is a very heavy iron gate that makes it clear that you ARE NOT walking into anything public. And this isn't some little swing gate on a foot path, this is a twenty-foot-long rolling gate that we use to keep people from breaking into our cars. There's a very obvious metal track to it. There's also a real front door on the house, with a porch and everything. This ain't it.

I opened the door expecting to find my upstairs neighbors, and instead--

"What? What are you doing here?"
"Oh... we were just... um... leaving this flyer..."

NOT buying it. She is holding exactly one other flyer in her hand. One is on the ground. None of the rest of them are carrying jack shit. Now my hearing may have taken a few hits, but I'm still not somebody you try and sneak up on or around. I heard that flyer hit the ground a few minutes prior. What the fuck have they been doing since? Going through my camping supplies outside, it seems.

"This is private property."
"Oh, really? We didn't see a sign..."

READ THAT AGAIN-- I SHIT YOU NOT, THAT IS WHAT SHE SAID.

"You don't need to see a sign! This is our damned driveway. There's a gate in front of it! You're all trespassing, get the fuck out of here, now."

They left. I go back for the phone, go outside. Are they knocking on my neighbors' doors? No, they're all getting into a car. Which I make it very clear I have just taken a picture of the license plate of.

I think we're going to have to start locking that gate again.

But whether they were fucking with me or not, who the fuck is stupid enough to say that? Jesus christ!

Off to the Desert

2009-08-29T18:30:51Z

I'll be leaving for a friend's wedding in Nevada (among other things) in a few short hours. Back in about a week (Tuesday after Labor Day).

Hold down the fort!

Finally, Something Good on Twitter

2009-08-26T08:42:19Z

This is BY FAR the funniest stuff I've read on Twitter. Not that I use Twitter. But I did read this:

http://twitter.com/fireland

AdBlock for Safari

2009-08-13T04:13:48Z

OK, I just got an AUDIO spam popup in Safari. Uh-uh. NO.

Is there ad-blocking software for Safari that works, or am I going back to Firefox (AdBlock Plus works, and well) and relegating Safari to be Hulu-Vision?

Thanks,
Matt

Depeche Mode in Mountain View is CANCELLED

2009-08-12T04:50:23Z

Well, with less than 24 hours to go, I just got word that the Depeche Mode show is cancelled. Something about the lead singer having whiskey-delta vocal chords or some tripe.

Oh well. I was looking forward to that. Got a good deal on the tickets a while back, too. I'm sure they'll send the refund by six week ground.

Anyway, thought there wasn't much chance I could be the only person here with tickets, so I thought I'd better share.

The Maze

2009-08-09T10:53:04Z

It's a great party. But I showed up alone, and my friends are all lit up on things I don't do. Which is... well, what it is.

I both miss and resent my ex at the moment.

Not much to be done about that, I suppose.

This is probably lack of food. I should've brought something to eat. But then, no big deal; I won't care tomorrow.

Nothing ever matters tomorrow.

Posted via LiveJournal.app.

breakpoint @ 2009-08-08T23:57:00

2009-08-09T06:57:17Z

Uh oh

Just broke the screen on the phone

Working for now but...

Posted via LiveJournal.app.

Still Life

2009-08-08T19:50:48Z

Once in a great while, something good shows up on Atom Films. If you're a Twilight Zone fan, you'll want to check this out.

http://www.atom.com/funny_videos/still_life/

I don't know what idiot put that in "funny_videos"; it's either "horror" or "suspense".