|
Run-Time Errors
[Recent Entries][Archive][Friends][User Info]
Below are the 20 most recent journal entries recorded in the "breakpoint" journal:[<< Previous 20 entries]
|
06:42 pm
[Link] |
Mail Call
A woman I occasionally bump into during the course of my BUSINESS day handed me a letter today. Physical mail is never good. Ever, ever, ever. I can't think of a piece of good news I've received by physical mail in... uh... well, at least ten years. So, now that I'm having a quick coffee on my way to a Scala presentation at Twitter, i had a second to open it. It was a Valentine's Day card. I'm really glad I didn't open it in front of her, because I winced-- twice. Once when I realized what it was, and once when I saw the long letter inside. Before you even ask: No-- I don't date at work. ESPECIALLY NOT internal security.
No-- she has kids.
No-- she's only familiar with the relatively polite, conservative, happy-face version of me I manage-- barely-- to put on from ten to six. So now... Well. Make that three winces. What do I do now? Posted via LiveJournal.app.
Current Location: US, California, San Francisco, San Francisco, Mission St, 778
Tags: via ljapp
|
01:51 am
[Link] |
Use the, uh, Force, Han
For those of you out there who may be both Feminists and Star Wars fans, please allow me to ruin your childhood forever:
http://www.youtube.com/watch?v=pSuLSU9aTLk&feature=player_embedded
Sigh.
|
|
03:49 am
[Link] |
Amadinejad Promises to "Disappoint" Enemies, Tyrants February 11th
"I am sure the Iranian people will do something on February 11, which will disappoint the enemies and the tyrants completely."
--Mahmoud Amadinejad
These words almost certainly refer to street demonstrations of pro-government factions. However, there are three recent wrinkles to keep in mind before writing such a remark off.
First, while the government is definitely being challenged, it is not unstable-- a revolution is entirely unlikely in the near term. Nevertheless, a successful demonstration of an ability to stand up to the west or Israel might very well help to re-solidify governmental control.
Second, a high-level Hamas official was recently killed abroad. A number of people, purportedly from (or, at least, with passports claiming origins in) various countries have been arrested. There is a widespread assumption, both within and beyond the Arab world, that the Israeli Mossad is responsible for the killing. The belief is so widespread that any alternate actual reality may not matter unless it is extremely convincing. A move against Israel would, so the theory goes, help unify Iran with like-minded neighbors.
Finally, Iran continues to attempt to procure high-grade defense materials from Russia, including the SA-300 (actually, Iran almost certainly wants the state-of-the-art SA-400, but good luck with that). Make no mistake, if there is one thing Russia, like the Soviet Union before it, actually does well in defense, it is missiles. It isn't so much a matter of technological prowess as just extremely well-refined processes. Even the somewhat-dated versions are quite potent, and meaningful modernization and upgrade kits have been sold for years (and, quite possibly, are where the real money is made). Russia has felt a need to reassert its military relevance in recent years, and it may yet be willing to stand up to the west more strongly through a proxy than directly, to test the waters. Iran, meanwhile, still wants to acquire hardware Moscow is still on the fence about selling.
Amadinejad's speech contained the following, as well:
"This year will see the definite failure of capitalism, inhuman liberalism and the start of globalization of the Islamic revolution."
This, of course, fails the "And I want a pony" test.
Nevertheless, as an exercise, it would be a good idea to at least take an exasperated look at the Domestic Threat Checklist for Iran. It's late, and I'm tired, so I'm going to cut to the chase on this one.
The only even marginally credible meaningful strategic threat Iran will have at some point against the domestic United States is the deployment of an EMP-optimized nuclear weapon via their emerging longer-range rockets high above America, probably from a cargo vessel offshore. The reasons this is their most credible strategy go roughly like this:
1. Modern missile guidance can be almost completely ignored; the damn thing just has to go almost straight up and then arc for a bit.
2. Anti-ballistic missile defense (which we do have a very limited, but not negligible, capability for) probably won't help, since the missile would be too high for mid-course interceptors and terminal-phase interceptors will be irrelevant, since the physics package will have activated prior to that point.
3. Various effects will greatly amplify the EMP effect of even a normal nuclear weapon when detonated high above the bulk of the atmosphere. A moderately-sized weapon that could be shrugged off when coupled with a crappy guidance system may nonetheless cause a significant EMP effect.
4. American vulnerability to, and cascade damage from, EMP effects continues, and will continue, to increase. I usually offer the ray of hope here that resupplying these materials from our trading partners abroad would only be a matter of days in many cases-- cargo ships will already be en-route due to their normal operations, after all-- but it would be, nonetheless, extremely disruptive.
So, for what it's worth, the one eye-rolling, devil's advocate domestic U.S. option Iran either has or will develop at some point is a stratosphere-exosphere EMP device.
So-- what do you, Joe Public, do?
Not a hell of a lot, honestly. The things you should do anyway, of course:
Three months of any life-critical medications. Always, always, no exceptions.
A week of water, changed out every three months.
A week of food, changed out as appropriate for the ration type.
If you have somewhere to store it safely-- not in the house-- ten gallons of gas.
However, for EMP, you should consider doing the following:
Spare, high-value electronics (meaning communications gear, really) should have the batteries removed, all antennas and long wires disconnected, and be packed into metal containers. Old metal ammo cans are great for cell phones, radios, and so on. While you're at it, make sure the waterproofing seals are still good. And those lids are supposed to scrape the sides of the can.
If you know what you're doing, you can compress steel wool carefully against the circuit boards, or otherwise ensure a safe shunt to keep long circuit traces from discharging into components.
While disconnected motors and refrigerators which are not plugged in at the time may be reasonably survivable, DO NOT expect to be able to run a refrigerator or motor off a UPS (uninterruptible power supply)! The startup current required for these is very high, and nasty for a UPS.
Outdoor antennas should always have lightning protection. It's unlikely the E1 spike from an EMP event would start a fire in most antenna systems, but it's worth thinking about, and you want the lightning protection anyway, so do it.
Anyway, there you go. EMP defense from a software engineer after three drinks. Sheesh. Whatever happened to Civil Defense?
|
|
02:00 pm
[Link] |
Retro Game Boxes for Modern Movies
These were too good not to share; click for more:
|
|
08:08 pm
[Link] |
VirtualBox + Fedora 12 = Not Recommended
As of today (19JAN2010), I have to warn against using Fedora 12 with VirtualBox as a guest OR a host. While I expect the problems to be relatively short-lived (30-60 days), at the moment they can be severe unless you are willing to work around them.
If you are trying to get used to VirtualBox, I recommend using the current version of VirtualBox with Fedora 11 instead.
If you have to run a Fedora 12 guest, I recommend falling back to an early 3.0.x release of VirtualBox.
If you have to run VirtualBox under a Fedora 12 host, you may or may not have problems, and may be able to work around them by rebuilding VirtualBox from source, if that is an option for you; alternately, try an early 3.0.x release of VirtualBox.
The blunders are a little vexing, but they are also not all that straightforward to troubleshoot. Problems this severe are rare, but they can occur when working on the two bleeding edges at once. =]
Share and enjoy,
Breakpoint
|
|
10:05 pm
[Link] |
AQAP US Attack Probable
Chatter is that it Looks like that last fiasco was a test run. I'm betting they didn't even give that guy a viable explosive. Meanwhile, two guys we were trying to watch seem to be nowhere to be found. Stay alert... Posted via LiveJournal.app.
Current Location: US, California, San Francisco, San Francisco, Post St, 936
Tags: via ljapp
|
|
04:21 pm
[Link] |
Damn it
Man I hate Christmas.
It wouldn't be so bad if it were just a matter of being alone, but everything is closed.
I guess I can work on configuring Nagios or something...
|
|
02:55 am
[Link] |
Iteration
GATTACAGATTACAGATTACAGATTACA goes my DNA, and CGUCUGAUGUCGUGUGUA goes the messenger RNA off to the ribosomes in my cells, cranking out proteins as ordered, built from whatever transfer RNA they just cranked out a fraction of a second ago.
CAGCAGCAGCAGCAGCAG, goes my DNA after a while, more and more-- the sequence growing from time to time when my cells divide and replace each other-- and some of the proteins get longer and longer.
Eventually, I will have cells full of so much bulk protein glue that nothing else gets done, and replication, of course, will not fix the problem.
This is how we will die, after cancer per se is cured, unless we determine how to cause our ribosomes to print catalytic enzymes that cleave those proteins into pieces small enough for our cells to dispose of, or somehow selectively shred the CAG repeats during translation or transcription.
This is also why it is currently less obvious that some of the population is already largely resistant to cancer: diseases like this, which will eventually affect most people late in life, are currently "rare"-- confined to people genetically predisposed to them, or cultures where couples breed late in life, when their own gametes are more likely to have a head start on the failure mode-- also afflict the very old, at the age we tend to think of as the end of an uncommonly long lifespan.
Shortly, however, that is going to become the median life expectancy.
These diseases aren't going to be "rare" at all.
|
|
02:35 am
[Link] |
I think
I need, badly need, something to just blow my mind again.
|
|
07:12 pm
[Link] |
Or Something
Apparently I'm an uncle.
Hmm.
|
|
01:55 pm
[Link] |
I hate the holidays
I hate the holidays. Everything is either closed or packed to the rafters with crazy people.
It's like Omega Man, only I can't just break in and take what I need to survive from the closed places, or shoot the crazy people. And I'm not playing chess across from a bust of Caesar.
Okay, maybe it's not like Omega Man. But it sucks.
Fuck it, I'm just going to do laundry, watch Full Metal Jacket on Netflix, and try not to think to hard about how much I hate being single.
|
|
12:14 am
[Link] |
Suggestions Welcome
What are you supposed to do when you're lonely, but tired of trying to start conversations? Posted via LiveJournal.app.
Current Location: US, California, Santa Clara, San Jose, N 2nd St, 245
Tags: via ljapp
|
|
10:04 pm
[Link] |
Lame
This whole "not having anybody to snuggle except once in a blue moon" thing really sucks. Of course, trying to date somebody seriously didn't work out too well either.
I guess I'm just killing time. At least it goes by faster every year.
|
02:10 pm
[Link] |
Last Night
Walking around in San Jose, I saw three women walking and some kid in a BMW pacing them and trying to hit on them. They were doing their best to blow him off, and he eventually sped up. They started muttering about him, and the car, and I laughed.
Me: I used to see a lot of that in Sacramento. But the thing there was, most of those cars were rebuilt salvage. You'd see a parking lot full of Mercedes and BMWs, and at least half of them had been totaled.
F1: Do you have a 401k?
Me: After this crash? Fuck no.
F2: Well, at least he's honest...
F3: That's true.
I shit you not.
|
|
11:23 pm
[Link] |
Quote of the Evening
F: "We were sitting here."
Me: "And Kennedy was the President, but things change." Posted via LiveJournal.app.
Current Location: US, California, Santa Clara, San Jose, State Hwy 87
Tags: via ljapp
|
|
02:29 am
[Link] |
Tonight's Exchange
F: (walks up) "Would you like to buy my friends and I a drink?"
Me: "Why would I do that?"
F: "Are you gay?"
Me: "No, I just like women who work for a living."
F: "I work for a living."
Me: "Do you believe in women's rights?"
F: "Yes..."
Me: "So buy your own drinks."
F: "You're gay. And you're baaaaaaaaald."
Me: "And you're flat."
I will never understand why women think calling a guy bald is an insult. Baldness is caused by excessive testosterone. Excessive testosterone means you either are, or at a minimum have the option of being on demand, a mean motherfucker who gets it the fuck done. It means you're an appreciating asset, as your earning potential increases year after year, as opposed to somebody leaning on their looks-- which decrease year after year, leaving them as a depreciating asset.
Yeah, sweetheart. Bald. Ohhhhhh, so bald. Mmmmmmmm, bald, bald, bald.
Actually, I can still pull off a crew cut. But with any luck, I'll be able to go Telly fucking Savalas-- and make a bid for Oracle-- in a few short years.
|
|
09:48 pm
[Link] |
SITREP
Alone in a bar, but making $65 an hour while having a beer isn't a bad way to go.
Thank god for cellular networks, and the fact that when I'm only using this laptop as a VPN/VNC terminal, the battery lasts for hours.
|
|
01:26 pm
[Link] |
Personal Knowledge Gained from Operations in California, 1995-2009
Rules of Engagement for 2010
1. Don't say anything you don't have to.
Follow this rule even when being friendly and outgoing.
2. There is only so deep you should allow yourself to fall in love-- ever.
No exceptions. Mandatory contingency damage mitigation. Make sure that if things ever go wrong, there is only so much damage they can do.
3. Keep things symmetric-- event by event, if possible.
Splitting the check is better than letting someone say "I'll get you next time". Planning an evening together beats planning everything yourself because the other person doesn't care.
4. Everybody wants something, even if they don't know what it is.
Internal motivation is more dangerous than deliberate motivation-- it's harder to stop, and the people slaved to it are convinced they have no idea where they're going, so they rarely admit they're doing it.
5. They never call.
Keep this in mind when you consider breaking rule 2 as part of "meeting" a girl, particularly when she introduces herself. See rule 4.
And, of course, the Old Rules still apply:
1. Never go against your gut.
2. Once is a coincidence, twice is interesting, three times is an enemy action.
3. Never underestimate the ability of a human being to rationalize the truth.
|
|
11:13 pm
[Link] |
Older
I feel like I finally have enough freedom of action to cut loose, and all my friends are at the point where they stay home all the time. Now what? Posted via LiveJournal.app.
Current Location: US, California, San Francisco, San Francisco, Tennessee St, 866
Tags: via ljapp
|
11:12 pm
[Link] |
Greetings from LoveFest
Old, but apparently never posted successfully: Very crowded. Ten thousand pretty girls. Happy me. Posted via LiveJournal.app.
Current Location: US, California, San Francisco, San Francisco, Connecticut St, 168
Tags: via ljapp
|
[<< Previous 20 entries] |
![[info]](http://l-stat.livejournal.com/img/userinfo.gif){kind=small}
breakpoint's journal